A study of 3-deoxy-D-arabino-heptulosonate 7-phosophate (DAHP) synthase gene (DHS) expression in Xanthium strumarium, and a partial sequence
|
Lucy Rubino
|
Introduction
To deter the constant onslaught of pathogens and insects, plants have evolved inducible defense systems that “turn on” only in the presence of an elicitor or threat. Jasmonic acid (JA) has been implicated as one of the molecules governing plant inducible defense signaling pathways using the following evidence: (1) Mutant plants that lack the ability to synthesize jasmonate are highly susceptible to attack by insect herbivores; (2) JA accumulates in wounded plants and in cell cultures treated with elicitors of pathogen defense; (3) Secondary metabolites accumulate in the presence of exogenously supplied JA through de novo transcription of genes involved in chemical defense.
Some of the genes that are induced by exogenous JA application are involved in aromatic amino acid biosynthesis, specifically the shikimate pathway. DAHP synthase is the first enzyme of this pathway and is therefore a crucial component of the biosynthesis of the ultimate products of this pathway: proteins and secondary metabolites. It is also important because the reaction it catalyzes is rate-limiting and it plays a major regulatory role in the pathway.
DAHP synthase can be produced from two distinct genes (DHS1 and DHS2) with different induction characteristics. DHS1 transcripts have been shown to increase in response to wounding, pathogenic attack and application of exogenous jasmonate. DHS2 transcripts have been shown to remain stable or slightly decline in response to wounding. Deduced protein sequences of DHS1 and DHS2 transcripts in Arabidopsis thaliana are similar except in their N-terminal regions.
Xanthium strumarium (common cocklebur) is a widespread weed that is of economic importance because it competes with soybean and peanut crops. This study specifically examines the levels of expression of the DHS suite of genes in X. strumarium treated with JA and control solutions for varying lengths of time. Primers were not designed to differentiate between the genes within the DHS suite because there is no sequence information for these genes in X. strumarium. Primer sequences were based on the region of an A. thaliana sequence of the DHS1 gene that exhibited the highest homology across multiple plant species. I hypothesized that the JA treatment would induce levels of the DHS transcripts, and that induction would be higher at the 2 hour treatment.
|
Figures
Figure 1-RT-PCR products for B-actin primers (courtesy of Jim Lewis) and DHS primers (Ex3F2.1: 5’CTGGTCTCTACTATGATTG3’ and Ex4R2.1: 5’GGTGTTTCCATGCATTGGATC3’). B-actin samples were subjected to 30 PCR cycles and DHS samples were subjected to 47. Individual leaves on X. strumarium plants were exposed to either C (control: 0.1% aqueous solution of Triton-X 100) or J (jasmonic acid: aqueous solution of 0.01% jasmonic acid and 0.1% Triton X-100) treatments for either 2 or 4 hours prior to RNA extraction. The intensities of these bands were quantified using Quantity One (v 4.2.2 Bio Rad) software.
Figure 2-Relative percent induction of the DHS transcript relative to the control treatment. Intensities were adjusted to account for differences in B-actin levels for each treatment. C = control treatment and J = jasmonic acid treatment. Control transcript levels were set to 100% and the relative induction of JA treatment was calculated.
Figure 3-Clustal-W alignment of RT-PCR product (Xanthium DAHP synthase) with three other sequences of the DHS gene from three different plant species
DHS primers designed using an A. thaliana mRNA sequence produced a band of the expected size (220 bp) for RNA. Contrary to my expectation, the DHS gene product is more strongly induced at the 4 hour exposure. The sequence of the RT-PCR product produced by the DHS primers illustrates the highest homology with other DAHP synthase genes in various plants. In the region of the DHS gene sequenced, the highest level of homology (75.3%) was illustrated in the comparison to European beech, which is surprising since X. strumarium is most closely related to lettuce which exhibited a 71% homology to this sequence. This sequence shared 73.5% homology to the A. thaliana sequence.
Future work should concentrate on getting more consistent levels of mRNA across all treatments. I would like to explore the temporal component of induction by creating a DHS expression profile by collecting RNA from leaves of a greater number of exposure times. I am also interested in comparing the DHS expression profiles of leaves of various ages.
Full Paper
Acknowledgments
I would like to thank JinSong Qui and Lisa Sarran for their support and advice. Thank you to Dr. Lewis for helping me plan and execute the project and for providing the greenhouse space, seeds and B-actin primer sequences. I would especially like to thank Dr. Rubin for opening his lab to us and facilitating the development of my skills in molecular biology. Thank you to all those who share the Dr. Rubin’s lab for tolerating all of the extra people milling about. And finally, thank you to Fordham University for funding this research.
