Identification of Hemolytic and Non-hemolytic Bacteria on Avian Residents of the Louis Calder Center




Dawn K. Konkoly

Introduction

Current out breaks of pathogenic avian influenza virus (H5N1) (Keawcharoen et al 2008) and increased distribution of Borrelia burgdorferi, a bacterial species of spirochete which is the causative agent of lyme disease (Ogden et al 2008), are attributed to avian vectors. Avian vectors pose a new area of public health concern particularly due to the long distance migration of many passerines (Poupon et al 2005).

Other than viruses and spirochetes, pathogenic bacteria are also of public health concern due to their involvement in human illness, infection, disease, and mortality. Pathogenic bacteria located internally on birds have been isolated from pharynxes and cloacae of avian species in the wild and in captivity (Lombardo 1996, Bangert 1988). For these internal pathogens a host must be competent that requires a host to acquire, maintain, and transmit an internal pathogen (Richter 2000, Mather 1989). However, many external bacteria can be transferred from animals to humans without competency requirements (Pell 1997). This lack of a requirement of competency could allow bacteria present on the feathers of avian individuals to be transmitted horizontally to humans. Bacterial communities living on the feathers of avian populations remains relatively understudied, seventeen strains of unique bacteria were isolated from four individual post breeding Eastern bluebirds in Lee County Alabama (Shawkey 2004) however this provides a minimal estimate of the potential pathogenic bacteria that may be vectored by avian individuals.

Public health concern has increased over hemolytic bacteria due to increasing reports of severe food posioning associated with bacteria with hemolytic properties (Drobniewski 1993). Hemolytic bacteria induce hemolysis or the break down of red blood cells. Hemolytic bacteria have been involved in food contamination leading to food poisoning outbreaks (Pell 1997), local infections of the skin, eye infections, and abscesses (Drobniewski 1993). The spread of hemolytic bacteria represents a public health concern. Avian vectors may play an important role in the vectorization of pathogenic hemolytic bacteria to new areas. In this study we hypothesize that avian individuals transport hemolytic bacteria.

Materials and Methods
Sampling was conducted at the Louis Calder Biological Field Station of Fordham University (41.13022°N, 73.73358°W), located in Armonk, New York .Field work was conducted on April 4th and April 6th of 2013. A total of 18 individuals were captured and swabbed for bacterial samples.

After collection all swabs were than rubbed on Blood Agar plates (Fisher Scientific, Pittsburg, PA, USA) within 6 hours of collection. Blood Agar plates were than incubated for 24 hours at 37°C.

Twelve bacterial colony isolates of hemolytic and non-hemolytic colony morphology were selected for DNA extraction. Bacteria colony isolates was first pre-treated using gram-positive optimized procedures for the Qiagen DNeasy® Blood and Tissue Kit (Madhumita 2009). DNA was than extracted using DNeasy® Blood and Tissue kit procedures as described by Qiagen(Qiagen, Hilden, Germany).

PCR was amplified using two primer sets for the 16SrDNA corresponding to Escherichia coli 16SrDNA gene sequence. The first set of primers consisted of 63F (5'CAGGCCTAACACATGCAAGTC 3') and 1389R (5'ACGGGCGGTGTGTACAAG 3') (Shawkey 2003) and the second set consisted of 522F (5’ CAGCCGCGGTAATAC 3’) and 1389R (5'ACGGGCGGTGTGTACAAG 3') (Ghasemi 2012).

PCR products were purified using a QIAquick® PCR Purification Kit (QIAGEN, Valencia, CA, USA). Purified PCR products were quantified for each sample by measuring the OD at 260 nm with an (Beckman Coulter ™, Gaithersburg, MD). The sent out for sequencing (Genewiz Inc., South Plainfield, NJ, USA). Sequences were identified using NCBI’s BLAST (National Center for Biotechnology Information, Bethesda, MD).


Results
All bacterial species identifications in BLAST had query covers > 99% and max identification > 98%. Eleven isolates were from the genus Bacillus and one isolate was from the genus Streptomyces . Of the twelve bacterial colonies selected for identification eight colonies were identified to species level. All identified hemolytic bacteria in this study had previously been identified to have hemolytic properties.

As described in figure 2 two species of non-hemolytic bacteria were identified to species level and two bacterial colonies were identified to genus level. Through alignment the bacterial isolate identified to genus level as Bacillus sp. was identified as a different isolate than the other two Bacillus species identified. This represents four unique species of non-hemolytic bacteria identified in this study. This represents the first report of B. megaterium and Streptomycetes sp. on avian feathers.

As described in figure 2 two species of hemolytic bacteria were identified to species level and one bacterial colony was identified to genus level. Through alignment the bacterial isolate identified to genus level as Bacillus sp. represents a different species as the other two bacterial species identified.

Discussion
To the investigators current knowledge these are the first reports of isolation of Streptomycetes sp. from the feathers of a white-breasted nuthatch and the first reports of B. megaterium from the feathers of a house finch and white-throated sparrow. B. pumilus, B. cereus, and B. licheniformis were previously identified on the feathers of eastern bluebirds (Sialia sialis) by Shawkey et al 2005. However, the study conducted by Shawkey et al did not investigate the potential hemolytic properties of the strains of B. pumilus and B. cereus, isolated. Therefore the potential for avian species to vector pathogenic bacteria was not addressed.

Bacterial colonies of hemolytic properties were isolated from all four avian species sampled and previous literature has identified these hemolytic bacteria to be of public health concern. This supports the hypothesis that avian individuals are potentially vectoring pathogenic hemolytic bacteria. In twelve bacterial colony isolates the investigator was able to identify two previously unreported bacterial strains on bird feathers. This supports previous claims that bacterial communities in general as well as pathogenic bacteria species are underestimated on the feathers of avian individuals. This hopes to increase interest and public awareness into the potential roles avian individuals play in vectoring pathogenic bacteria.

Figures


Figure 1-Blood Agar plate of the Tufted Titmouse (Baeolophus bicolor) with non-hemolytic and hemolytic bacterial growth.


Figure 2-Bacterial species isolated and identified on four avian species at the Louis Calder center


Full Paper

Acknowledgments

I would like to thank Kate Reid and Catharina Grubaugh for endless hours of patience. Dr. Rubin for his expertise and J. Alan Clark for his assistance in collection of samples for this study. I would like to thank Chelsea Butcher for her scarf.

Abstract
Drobniewski, F. 1993. Bacillus cereus and related species. Clinical microbiology reviews 6:324-338.

Folarin Anthony Oguntoyinbo and O. M. Oni. 2004. Incidence and Characterization of Bacillus cereus isolated from traditional fermented meals in Migeria. Journal of Food Protection 67:2805-2808.

Irmgard Suominen, Maria A. Andersson, Magnus C. Andersson,
Anna-Maija Hallaksela, Peter Kampfer, Frederick A. Rainey, and M. Salkinoja-Salonen. 2001. Toxic Bacillus pumilus from indoor air, Recycled Paper Pulp, Norway Spruce, Food poisoning outbreaks and clinical samples. Systematic and applied microbiology 24:267-276.

Keawcharoen, J., D. van Riel, G. van Amerongen, T. Bestebroer, W. Beyer, R. van Lavieren, A. Osterhaus, R. Fouchier, and T. Kuiken. 2008. Wild ducks as long-distance vectors of highly pathogenic avian influenza virus (H5N1). Emerging infectious diseases 14:600-607.

Lombardo, M. P., P. A. Thorpe, R. Cichewicz, M. Henshaw, C. Millard, C. Steen, and T. Zeller. 1996. Communities of cloacal bacteria in tree swallow families. The Condor 98:167-172.

Marie-Angčle, P., E. Lommano, P.-F. Humair, V. Douet, O. Rais, M. Schaad, L. Jenni, and L. Gern. 2006. Prevalence of Borrelia burgdorferi sensu lato in ticks collected from migratory birds in Switzerland. Applied and environmental microbiology 72:976-985.

Mather, T., S. Telford, A. MacLachlan, and A. Spielman. 1989. Incompetence of catbirds as reservoirs for the Lyme disease spirochete (Borrelia burgdorferi). The Journal of parasitology 75:66-69.

Ogden, N., L. Lindsay, K. Hanincová, I. Barker, M. Bigras-Poulin, D. Charron, A. Heagy, C. Francis, C. O'Callaghan, I. Schwartz, and R. Thompson. 2008. Role of migratory birds in introduction and range expansion of Ixodes scapularis ticks and of Borrelia burgdorferi and Anaplasma phagocytophilum in Canada. Applied and environmental microbiology 74:1780-1790.

Pell, A. 1997. Manure and microbes: public and animal health problem? Journal of Dairy Science 80:2673-2681.

R. L. Bangert, B. R. Cho, P. R. Widders, E. H. Stauber, and A. C. S. Ward. 1988. A survey of aerobic bacteria and fungi in the feces of healthy Psittacine birds. Avian Diseases 32:46-52.

Richter, D., A. Spielman, N. Komar, and F. Matuschka. 2000. Competence of American robins as reservoir hosts for Lyme disease spirochetes. Emerging infectious diseases 6:133-141.

Shawkey, M., K. Mills, C. Dale, and G. Hill. 2005. Microbial diversity of wild bird feathers revealed through culture-based and culture-independent techniques. Microbial ecology 50:40-47.

Shawkey, M. D., S. R. Pillai, and G. E. Hill. 2003. Chemical warfare? Effects of uropygial oil on feather-degrading bacteria. Journal of Avian Biology 34:345-349.

Tena, D., J. Martinez-Torres, M. Perez-Pomata, J. Sáez-Nieto, V. Rubio, and J. Bisquert. 2007. Cutaneous infection due to Bacillus pumilus: report of 3 cases. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 44:e40-42.

Younes Ghasemi, Maryam Shabazi, Sara Rasoul-Amini, Mohammad Kargar, Azam Safari, Aboozar Kazemi, and N. Montazeri-Najafabady. 2012. Identification and characterization of feather-degrading bacteria from keratin-rich wastes. Annals of microbiology 62:737-744.


This document was last modified 05/08/2013.
This site is powered by the versatile Zope platform.
This is a project of the Biology Department of Fordham University
Biotechniques.org Home