Understanding Osteoclast Development: A first step in identification of therapies for osteoporosis




Anthony Evans

Introduction

Bone as the major structural support for the human body, must undergo a continuous cycle of remodeling to ensure the bone stays strong. Osteoclasts are cells responsible for the breakdown of bone so that it can later be rebuilt by osteoblast cells(Crockett,2011). Osteoporosis is a metabolic bone disease, which occurs when osteoclast activity is higher than the activity of osteoblasts. It affects 50% of women and 25% of men over 50 years of age (Teitlebaum, 2007). Osteoporosis is characterized by weak and porous bone, which leads to more frequent breaks, and long term disability. Osteoclasts are differentiated from myeloid precursor cells. It has been shown that differentiation can be induced in vitro by treating myeloid cells with a combination of the compounds vitamin D3 and tetradecanoyl phorbol acetate(TPA) (kido,2003). The gene that initiates this differentiation is RANK.

RANK is a gene that encodes for a receptor, that when bound to RANK ligand, initiates the signal for myeloid precursors to differentiate into mature osteoclasts (Xing, 2005). Two genes important in mature osteoclasts are MMP9 and tartrate resistant acid phosphatase(TRAP). MMP9 is a gene that encodes for a protein that mature osteoclasts secrete. The MMP9 protein is a metaloprotease that aids in the breakdown of bone matrix (Brunni-Cardoso, 2010). The biological function of the protein encoded by the TRAP gene is not well characterized, but TRAP has been widely used as a marker for the presence of mature osteoclasts. (Minkin, 1982).

The goal of the Rubin lab is to find compounds that can compromise osteoclast gene expression. In order to better develop these treatments for osteoporosis, the induction of gene expression of several osteoclast genes during differentiation needs to be better understood. In this study, the induction of three osteoclast specific genes: RANK, MMP9, and TRAP was observed over a 24 hour period via quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). In future studies this knowledge will allow us to determine the effectiveness of treatments designed to alter osteoclast gene expression.

Materials and Methods
Cell Culture:
HL-60 cells were generously donated by Dr. Sylvia Anderson. At time zero cells were treated with 10nM vitamin D3 and 50nM TPA. Untreated cells were used as a control.

RNA isolation:
At the time points of 0,0.5,1,2,4,8,12,and 24 hours after treatment, cells were transferred to a 1.5 ml Eppendorf tube, and centrifuged at 2 rpm for 6 minutes. The media was then taken off top of the cells, and cells were resuspended in 350 ul of RLT lysis buffer plus B-mercaptoethanol.

RNA isolation:
All samples were placed through a Qiagen qia-shredder column and spun at 16 x g for 2 minutes to remove genomic DNA. The RNA was then purified using Qiagen's RNeasy plus mini kit by the Qiagen Qiacube automated system, following the manufacturer's protocol.

Quantitative RT-PCR:
qRT-PCR was performed for the following genes(figure 1):
RANK:
10F:gatcggtacagtcgaggaag
10R:tgctgcgagtttgaggagtg

MMP9:
9F:ttctacggccactactgtgc
10R:gaatcgccagtacttcccatc

TRAP:
6F:tcctggctcaagaaacagctg
7R:ctcatcttgcaggtactgcaga


Results

RANK: RANK mRNA expression started to increase at two hours after treatment with vitamin D3 and TPA. RANK expression continued to increase up to 12 hours post treatment.

MMP9: MMP9 expression began to increase at 4 hours after treatment. MMP9 continued to increase up to 12 hours after treatment, where it levels off.(Figure 2)

TRAP" TRAP expression increase started around 8 hours after treatment, and continued to increase through the 24 hour time point (Figure 2).

It was seen that RANK, was induced first, followed by MMP9 and TRAP. There is an increase in all three genes at 12 hours after treatment.(Figure 4)

Discussion
RANK expression started to increase at around 2 hours after treatment with vitamin D3 and TPA, indicating it does not take very long for D3 and TPA to begin to induce the differentiation of the myeloid cells into osteoclasts. RANK expression continued to increase up to 12 hours, after which it began to decrease. This could indicate that the cells are reaching full differentiation into osteoclasts around that time, therefore no longer needing the RANK signal.

MMP9 expression started to increase at 4 hours and continued to increase up to 12 hours, where the expression no longer changed. Further studies need to be done to determine whether or not this pattern is mimicked in the production of the MMP9 protein.

TRAP expression started to increase at 8 hours and continued to increase through 24 hours.

The expression of RANK before MMP9 and TRAP expression was expected because it is known that RANK initiates the signal for differentiation.

The increase of all three genes through the 12 hour time point suggests that, for future studies, the effectiveness of compounds designed to impact osteoclasts gene expression can be assessed following following a 12 hour incubation with vitamin D3 and TPA.

References
Bruni-Cardoso, A.; Johnson, L.C., Vessella, R.L., Peterson, T.E., Lynch, C.C. 2010. Osteoclast-Derived Matrix Metalloproteinase-9 Directly Affects Angiogenesis in the Prostate Tumor–Bone Micro-environment. Mol Cancer Res 8: 459.

Crockett,J., Rogers, M., Coxon,F., Hocking, L., Helfrich, M. 2011 Bone remodeling at a glance. J. Cell Science. 2011; 124(7): 991-998.

Minkin, C. 1982 Bone acid phosphatase: tartrate-resistant acid phosphatase as a marker of osteoclast function. Calcif Tissue Int. 34(3): 285-90

Shinsuke Kido, Daisuke Inoue, Kenji Hiura, Wilde Javier, Yuji Ito, Toshio Matsumoto. 2003 Expression of RANK is dependent upon differentiation into the macrophage/osteoclast lineage: induction by 1,25 dihydroxyvitamin D3 and TPA in a human myeloid cell line, HL60. Bone 32(6): 621-629.

Teitlebaum, S. 2007 Osteoclasts: What do they do and how do they do it. Am. J. Path. 170(2): 427-435.

Xing, L., Schwarz, EM., Boyce, BF. 2005 Osteoclast precursors, RANKL/RANK, and immunology. Immunol Rev. 208: 19-29

Figures


Figure 1-RANK, MMP9, and TRAP transcripts


Figure 2-Change in expression of RANK transcript over 24 hours


Figure 3-Change in expression of MMP9 and TRAP transcript over 24 hours


Figure 4-Comparison of the expression of 3 osteoclast specific genes


Abstract
Osteoporosis is a metabolic bone disease that impacts a large number of individuals over 50 years of age. It occurs when osteoclasts, cells that break down bone, are more active than osteoblasts, the cells that build up bone. This leads to porous and easily broken bones. To better develop treatments for osteoporosis, a better understanding of the induction of genes involved in osteoclasts development and function is needed. Cells were treated with vitamin D3 and Tetradecanoyl phorbol acetate to induce differentiation. RNA was harvested at several time points between 0 and 24 hours. Expression of osteoclast genes RANK, MMP9, and TRAP were monitored using quantitative RT-PCR. RANK expression was induced within the first 2 hours after treatment. MMP9 expression was induced next, with an increase of expression starting between 2 and 4 hours after treatment. TRAP mRNA expression did not begin until around 8 hours after treatment. All three genes expression increased up through 12 hours. This indicates that, for future studies, 12 hours after treatment is a sufficient point at which to monitor the effectiveness of compounds on osteoclast gene expression.

Full Paper

Acknowledgments

I would like to thank Dr. Sylvia Anderson for all of her time, effort, and guidance throughout this project. I would also like to thank Dr. Rubin for his help in designing this experiment, as well as for making this project possible. Finally I would like to thank Catharina Grubaugh and Kate Reid for all their support through this project as well as throughout the class.


This document was last modified 05/16/2014.
This site is powered by the versatile Zope platform.
This is a project of the Biology Department of Fordham University
Biotechniques.org Home