Exome Sequencing: A Case Study




Tamara Pluchenik

Introduction

Retinitis Pigmentosa (RP) is a group of heterogeneous genetic eye conditions, with over 100 genes implicated in syndromic and non-syndromic forms. It is transmitted through all modes of inheritance, and has a frequency of about 1 in 4000. Symptoms include night blindness, initial peripheral vision loss, followed by complete constriction of visual field, pigmentation of the fundus, cataracts, vascular attenuation, photophobia, and drusen of the optic nerve head. In RP the rods are thought to begin the degeneration causing cones to degenerate as a secondary result. The exact mechanism of this process is still poorly understood. However, the etiology of the disease differs depending on the gene implicated. This makes identification of the causative gene a top priority for affected individuals, in the hopes of finding up and coming gene specific therapies. Here we aim to identify the causative mutation in a patient whose causal variant is not any of the known RP genes.

Materials and Methods

Patient, parents, and 5 siblings underwent testing of retinal electrical function through electroretinogram testing (ERG), to ascertain whether they were affected or not. Blood was collected from each individual and sent to GeneDx for exome sequencing. Variant Call Files (VCFs) as well as Binary Sequence Alignment (BAM) Files were used as input into the variant annotation software. Varseq - variant annotation and filtering software was used to narrow the variants down to a manageable list of possible candidate genes. Variants were filtered through different workflows based on specific criteria such as de novo, dominant, compound heterozygous, and recessive inheritance patterns. Based on the pedigree and family history a recessive mode of inheritance is suspected and those variants were selected for further analysis. Out of the 13 recessive variants identified we focused on the gene found to be closely related to retinal function in the literature. Saliva was collected from the parents for DNA isolation. Primers were designed to amplify the single exon FZD1 gene:
FZD1F: GAGCTGGGAACTTTGTGC
FZD1R: CATGATGGTCTGGTTGTACG
PCR was performed to amplify the desired 352 bp region. The expected fragment was identified through gel electrophoresis and sent out for Sanger sequencing.

Results

PCR products from the mom and dad were sent out for Sanger sequencing. Data showed double peaks after the 206th base pair of the PCR product. Upon further analysis the double peaks were found to be caused by a 3 base pair insertion at that site. The insertion of GCC adds on an additional proline to the amino acid sequence. The sequence of the alternate allele aligned with the reference sequence downstream of the 3 nucleotide insertion. This data confirms that the parents are both heterozygous for the alternate allele and that the insertion is present in both of them.


Discussion

Future direction for the project would include, sequencing the rest of the family members to confirm that zygosity coincides with phenotypic findings and with the original exome sequencing data. Additionally, large population samples should be tested to calculate the frequency of the allele. Any frequent variant would be ruled out, since it would mean that the condition’s prevalence would be higher if this allele was found at high frequencies in the population.


Reference

Retnet 2017 https://sph.uth.edu/retnet/home.htm

Nguyen TT, Hull S, Roepman R, et al Missense mutations in the WD40 domain of AHI1 cause non-syndromic retinitis pigmentosa Journal of Medical Genetics Published Online First: 25 April 2017. doi: 10.1136/jmedgenet-2016-104200

Fahim AT, Daiger SP, Weleber RG. Nonsyndromic Retinitis Pigmentosa Overview. 2000 Aug 4 [Updated 2017 Jan 19]. In: Pagon RA, Adam MP, Ardinger HH, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2017. Available from: https://www.ncbi.nlm.nih.gov/books/NBK1417/

Ferrari, Stefano et al. “Retinitis Pigmentosa: Genes and Disease Mechanisms.” Current Genomics 12.4 (2011): 238–249. PMC. Web. 10 May 2017.

Narayan, D. S., Wood, J. P. M., Chidlow, G. and Casson, R. J. (2016), A review of the mechanisms of cone degeneration in retinitis pigmentosa. Acta Ophthalmol, 94: 748–754.

Abstract

Due to the heterogeneity of the underlying genetic causes of RP, identification of the causative gene can be extremely challenging. Of the approximately 100 genes implicated in the syndromic and non-syndromic forms of the disease, it is believed that this accounts for only about half of its causative mutations. Identification of the causative variant in RP is extremely important in light of developing therapies that require genetic diagnoses in order to treat the disease. In recessive modes of inheritance, it is also important for patients and their family members to identify the causative gene, as a form of prevention when planning to have a family. In this study we analyze exome sequencing data of a patient with RP, whose causative mutation has otherwise not been identified. The FZD1 gene was selected because of the known role frizzled proteins play in retinal function. PCR was performed and FZD1 products were sequenced to confirm a putative insertion.

Figures


Figure 1-PCR products for FZD1 forward and reverse primers visualized by electrophoresis on 1% agarose gel


Figure 2-Sanger sequencing histogram showing double peaks possible site of insertion.


Figure 3-Alignment of sequencing data showing site of insertion in the alternate allele. Both parents carry one copy.


Full Paper

Acknowledgments

I'd like to thank Dr. Berish Rubin for his time, guidance, and commitment to mentor his students. A special thank you to Dr. Sylvia Anderson for her help in designing primers, and for her time in discussing this case. Thank you to Catharina Grubaugh and Anthony Evans for all their help throughout the course.


This document was last modified 05/15/2017.
This site is powered by the versatile Zope platform.
This is a project of the Biology Department of Fordham University
Biotechniques.org Home