Introduction
Abstract |
Figure 1-Visualization of PCR product. Lane 1, Ladder. Lanes 2 - 4, samples collected from the surface of the lake. Lanes 5-7, samples collected from one meter in depth. Lanes 8-10, samples collected from 3 meters in depth. Lanes 2, 5 and 8, PCR using universal primers. Lanes 3, 6 and 9, PCR using archaeal primers. Lanes 4, 7 and 10, PCR using bacterial primers.
Figure 2-Visualization of PCR product. Top, samples collected from the bottom of the lake. Bottom, positive control samples. Lane 1, Ladder. Lane 2, PCR using universal primers. Lane 3, PCR using archaeal primers. Lane 4, PCR using bacterial primers.
Figure 3-Alignment of the partial sequence of the insert present in clone 8 with an uncultured archaea (Val 35). The insert consisted of DNA amplified by PCR using archaeal primers on lake water samples collected from the bottom of Calder Lake. The sequence was determined using the dideoxy method and aligned using MacVector.
Materials and Methods
Sample Collection and DNA Extraction
Water samples were collected from the surface, 1 meter, 3 meters, and the bottom of Calder Lake on March 5, 2002. Samples were collected using a peristaltic pump and were then transported to the laboratory for processing (<15 minutes).
Samples were prepared essentially as described by Øvreas et al (1997). Briefly, cells from one milliliter aliquots of the lake water samples were harvested by centrifugation at >12,000 x g for 30 minutes. The cells were then washed once in 0.2 um filtered phosphate buffered saline (PBS). Samples were then centrifuged at >12,000 g for an additional 15 minutes and the supernatant removed. The samples were resusupended in 30 ul 0.02 um filtered deionized water, frozen and thawed at 70 degrees Celsius, then centrifuged at >12,000 x g for 15 minutes to extract and separate the DNA from the lysed cells. The supernatant of these samples was then used as the template for PCR using methods described below. The archaea Halobacterium Salinarium was used as a positive control for this experiment. Positive control samples underwent the same processing as the experimental samples with the following exceptions. The organism was suspended in 8% NaCl (to prevent premature lysing of the organism). The samples were then processed as described for the experimental samples, however the PBS used was amended to 8% salinity to prevent premature lysing of the samples.
PCR Primers and Reaction Conditions
The DNA from the processed samples was probed using a primer set specific to 16S rRNA gene sequences specific the domain archaea, the domain bacteria and a universal set of primers specific to all prokaryotic organisms. The following primers were used to amplify archaeal genetic material (5’TTCCGGTTGATCCTGCCGGA 3’) and (5’ CCCGCCAATTCCTTTAAGTTTC 3’) (Jurgens et al 2000). The primer set used to amplify bacterial DNA was (5’ AGAGTTTATCCTGGCTCAG 3’) and (5’ GGTTACCTTGTTACGACTT 3’) (DeLong 1992). The universal primers were as follows (5’ GTGCCAGCMCCGCGG; M represents A or C) and (5’GTTACCTTTTACGACTT 3’) (Sekiguchi et al 1998). The reaction consisted of 10 ul of washed cell suspension, 1 ul of each primer, 4 ul dNTP, 1.5 ul magnesium chloride, 0.25 ul Taq polymerase, 5 ul PCR buffer, diluted to a final volume of 50 ul with sterile water. Reaction conditions were as follows: 92 degrees C for 2 minutes followed by 45 cycles of : denaturation at 92 degrees C for 1 minute, annealing at 55 degrees C for 30 seconds, and extension at 72 degrees C for 1 minute, followed by a final extension at 72 degrees C for 6 minutes. Reaction products were checked for the presence of amplified DNA by staining with ethidium bromide and electrophoresis in agarose gel. Product obtained using the archaeal and universal primers was then used for cloning and subsequent sequencing.
Ligation Cloning and Purification of PCR Product
PCR products were purified using a QIAquick Purification Kit (Chatsworth, CA). These products were ligated into the pGEM vector (Promega, Madison, WI). JM109 cells were transformed with the vector and allowed to incubate overnight on media containing luria broth, ampicillin, Xgal and IPTG. Colonies believed to contain the insert were randomly chosen and analyzed to confirm the presence of plasmids containing an insert using the Quiagen miniprep analysis protocol. Colonies confirmed to contain the insert were then inoculated in 10 ml of luria broth containing 10 ul of ampicillin (10 ug/ul). Samples were then incubated overnight at 37 degrees C shaking at 220 rpm. DNA from inoculated samples was then isolated and purified using the Quiagen anion exchange resin.
DNA Sequencing
The optical density of DNA products purified as above was used to determine the purity and concentration of the products. 50 fmol of DNA from clones containing the PCR product from above was then used as the template for sequencing using a variation of the dideoxy method of sequencing. Briefly, the DNA was mixed with 4 ul 10x cycling buffer, 0.2 ul radiolabled ATP and diluted with distilled water to a final volume of 30 ul. Aliquots from this solution were then added to tubes containing either ddGTP, ddATP, ddTTP, or ddCTP, either an SP6 or T7 primer and mineral oil. The reaction was then subjected to 35 cycles of: denaturation at 94 degrees C for 30 seconds, annealing at 58 degrees C for 30 seconds and extension at 72 degrees C for 1 minute. 4 ul of stop solution was then added and the reaction was denatured at 94 degrees C for 3 minutes, then electrophoresed on a polyacrylimide gel and visualized by exposing the gel to x-ray film overnight.
Results
Characterization of the Water Column
Samples collected from varying depths of Calder Lake were analyzed using PCR with primers specific for either all prokaryotic organisms, organisms in the domain archaea or organisms in the domain bacteria. Samples collected from 0, 1 and 3 meters yielded a product approximately 1 kb in length using the universal primers and 1.5 kb in length using the bacterial primers, however these samples did not yield product using archaeal primers (Figure 1). Samples collected from the bottom of the lake yielded products of approximately 1 kb and 1.5 kb using universal and bacterial primers respectively. Additionally, these samples yielded a product approximately 900 bp in length using the archaeal primers (Figure 2). Product was also obtained on positive control samples using the universal primers and the archaeal primers, however, no product was obtained using the bacterial primers. (Figure 2).
DNA from clones containing an insert of the product amplified using archaeal primers in samples collected from the bottom of the lake were partially sequenced. The determined sequence for each clone was analyzed using a BLAST query for nucleotide sequence. Results of the BLAST for the sequence of clone 8, which was transformed with a vector containing the PCR product amplified using the archaeal primers, indicated that the closest match was to an uncultured archaea found in a lake in Finland (Figure 3).
Discussion
The results of this experiment indicate that archaea are indeed present in Calder Lake, however at the time of sampling they were only detected in the bottom portion of the Lake (>6m). Other experiments involving the collection of archaea in freshwater systems have shown similar results (Jurgens et al 2000). A possible next step would be to sample the lake immediately after it has turned over, as well as sampling the lake after it has stratified in the summer.
Partial sequences of the product amplified by the archaeal primers and propagated in JM109 have been determined. A BLAST using these sequences indicate that, while there was no exact match for the sequence of nucleotides found in the lake, the closest match of this sequence is to an uncultured archaea in a lake in Finland. It is not surprising that an exact match for the sequence was not found. Archaea from Calder Lake have yet to be isolated and cultured and this domain of microorganism is not yet very well characterized in ecosystems outside of Calder Lake. The products isolated from the clones described in this report should be sequenced in their entirety to allow a more thorough characterization. Additionally, using the techniques employed in this report it is not possible to determine how many species of archaea are actually present in Calder Lake. Other techniques, such as single strand conformational polymorphism (SSCP) may be useful in providing an idea of how many species of archaea are being detected by the PCR, leading to a more detailed characterization of the archaeal portion of the microbial loop in Calder Lake.
I would like to thank Rocco Coli and Sabrina Volpi for their guidance and advice. Thanks are also owed to Alissa Perrone for countless helpful discussions. I would also like to thank Dr. Berish Rubin for explaining the concepts behind most of the techniques used in this report and Dr. John Wehr for technical assistance and advice regarding the limnology portion of the report.
References
Azam, F., T. Fenchel, J.G. Field, J.S. Gray, L.A. Meyer-Reil, and F. Thingstad. 1983. The Ecological Role of Water-Column Microbes in the Sea. Marine Ecology Progress Series 10: 257-263.
DeLong, Edward F. 1992. Archaea in coastal marine environments. Proceedings of the National Academy of Sciences 89: 5685-5689.
Lemke, Michael J., Christopher J. McNamara and Laura G. Leff. 1997. Comparison of methods for the concentration of bacterioplankton for in situ hybridization. Journal of Microbiological Methods 29: 23-29.
Jurgens, German, Frank-Oliver Glockner, Rudolf Amann, Aimo Saano, Leone Montonen, Markit Likolammi, Uwe Munster. 2000. Identification of novel archaea in bacterioplankton of a boreal forest lake by phylogenetic analysis and fluorescent in situ hybridization. FEMS Microbial Ecology 34: 45-56.
Massana, Ramon, Lance T. Taylor, Alison E. Murray, Ke Y. Wu, Wade H. Jeffrey and Edward F. DeLong. 1998. Vertical distribution and temporal variation of marine planktonic archaea in the Gerlache Strait, Antarctica, during early spring. Limnology and Oceanography 43: 607-617.
Øvreås, Lise, Larry Forner, Frida Lise Daae, and Gigdis Torsvik. 1997. Distribution of bacterioplankton in meromictic Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Applied and Environmental Microbiology 63: 3367-3373.
Pernthaler, Jakob, Frank Oliver Glöckner, Stefanie Unterhholzner, Albin Alfreider, Roland Psenner and Rudolf Amann. 1998. Seasonal community and population dynamics of pelagic bacteria and archaea in a high mountain lake. Applied and Environmental Microbiology 64: 4299-4306.
Petersen, Joan. 1999. Phylogenetic affiliations and physiological traits of freshwater bacteria. Ph.D. Dissertation, Fordham University.
Pomeroy, Lawrence R. 1974. The ocean’s food web, a changing paradigm. Bioscience 24: 499-504.
Porter, Karen G. and Yvette S. Feig. 1980. The use of DAPI for identifying and counting aquatic microflora. Limnology and Oceanography 25: 943-948.
Sekiguchi, Yuji, Yoichi Kamagata, Kazuaki Syutsubo, Akiyoshi Ohashi, Hideki Harada and Kazunori Nakamura. 1998. Phylogenetic diversity of mesophilic and thermophilic granular sludges determined by 16S rRNA gene analysis.
Toolan, Tara, John D. Wehr and Stuart Findlay. 1991. Inorganic phosphorus stimulation of bacterioplankton production in a meso-eutrophic lake. Applied and Environmental Microbiology 57: 2074-2078.
Woese, Carl R., Otto Kandler and Mark L. Wheelis. 1990. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria and Eucarya. Proceedings of the National Academy of Science 87: 4576-4579.
| This document was last modified 01/31/2006. This site is powered by the versatile Zope platform. | This is a project of the Biology Department of Fordham University |