Introduction
ABSTRACT |
Figure 1-Total RNA of six neuroblastoma cell lines: Non-amplified N-myc - 1. SK-N-SH (SH-SY-5Y), 2. SMS-JMN, and 3. LA-N-6. Amplified N-myc - 4. LAN-1 (LA1-55n), 5. BE(2)-M17, and 6. KCN-69N. The bands across the top represent genomic DNA of each respective cell line. The 28S and 18S ribosomal subunits are labelled and represented in each cell line. Lane marked 'L' contains a 100bp ladder.
Figure 2-PCR of six neuroblastoma cell lines for N-myc (lanes 1,5,9,13,17, & 21), Id2 (lanes 2,6,10,14,18, & 22), Survivin (lanes 3,7,11,15,19, & 23), and Actin (lanes 4,8,12,16,20, & 24). The cell lines are: Non-amplified N-myc: 1. SK-N-SH (SH-SY-5Y) (lanes 1-4), 2. SMS-JMN (lanes 5-8), 3. LA-N-6 (lanes 9-12) & Amplified N-myc : 4. LAN-1 (LA1-55n) (lanes 13-16), 5. BE(2)-M17 (lanes 17-20), 6. KCN-69N (lanes 21-24). Lane marked 'L' contains a 100bp ladder.
Figure 3-Densitometric Scanning Values. Highest densitometric scanning values of Actin, N-myc, Id2, and Survivin are each 100% and the remaining values for each gene are computed as percentages of these correspondingly. N-myc values for cell lines #1 and #2 are not available.
MATERIALS AND METHODS
Cell Culture
Neuroblastoma cell lines SK-N-SH (SH-SY-5Y), SMS-JMN, LA-N-6, LAN-1 (LA1-55n), BE(2)-M17, and KCN-69N were provided by Barbara Spengler and Dr. Robert Ross, Fordham University, New York. The cells were cultured at approximately 2-3x107 cells per flask. One 75-cm2 flask of cells from each cell line was trypsinized, collected, centrifuged at 4000 rpm for 5 minutes, and supernatant discarded. The pellets were then washed with PBS, centrifuged again at 4000 rpm for 5 minutes, and supernatant discarded.
Total RNA Isolation
Total RNA was extracted from the cell pellets using Ambion’s RNAqueous Phenol-Free Total RNA Isolation Kit and performed according to the manufacturer’s specifications. All centrifugations in this protocol were performed at 13,000 rpm. Each cell pellet was homogenized thoroughly in 1 ml of lysis/binding solution and then 1 ml of 64% ethanol. The lysate/ethanol mixture was applied to a filter, centrifuged for 1 minute, and flow-through discarded. The filter was then washed with 700 uls of Wash Solution #1, centrifuged for 1 minute, and flow-through discarded. This washing step was repeated twice for 500 uls of Wash Solution #2/3 and any last traces of wash solution were removed by further centrifugation. The RNA was eluted by adding 60 uls of RNase-free distilled water at 70°C to the filter cartridge, heating the tube at 70°C for 10 minutes, and then centrifuging for 1 minute. These steps are repeated after adding another 60 uls of RNase-free distilled water to the filter cartridge to have a total volume of 120 uls of total RNA. One ug of total RNA for each of the six cell lines were run on a 0.8% agarose gel containing ethidium bromide and viewed under UV light. A picture was taken of the gel using the Quantity One computer program.
DNase Treatment
Total RNA was DNase treated using Ambion’s DNA-free DNase Treatment and Removal Reagents. Briefly, 0.1 volume of 10x DNase Buffer and 2 units of DNase 1 were added to 2 ugs of each total RNA sample and the mixture incubated at 37°C for 30 minutes. Then 0.1 volume of resuspended DNase Inactivation Reagent was added, the mixture incubated at room temperature for 2 minutes, and finally centrifuged at 13,000 rpm for 1 minute to pellet the reagent.
First strand synthesis by reverse transcription (3’ RACE)
Dnased RNA was used in the production and amplification of cDNA by heating a mixture of 1 ug of Dnased RNA and Rnase-free distilled water (for a total volume of 9.4 uls) at 70°C for 10 minutes and then cooling the mixture on ice. Next, the following were added: 4 uls of 5x Reverse Transcriptase First Strand Buffer, 4 uls of 2.5mM dNTP’s, 2 uls of 0.1M DTT, 0.6 uls of Qt primer, and finally 1 ul of Superscript 2 RT. The mixture was incubated at room temperature for 5 minutes and then placed in the thermal cycler under the following conditions: 42°C for 1 hour, 50°C for 10 minutes, 70°C for 15 minutes (to inactivate the RT), and a final hold at 4°C. Finally, 0.075 units (0.75 uls) of RNase H was added to the mixture and then incubated at 37°C for 20 minutes.
Primer Synthesis and Preparation
After designing the desired primers, the primers were generously synthesized in the oligosynthesizer by Dr. Sylvia Anderson, Fordham University, New York. Once they were synthesized, they were deprotected by incubating at 70°C for 1-16 hours. After deprotection, 50 uls of each primer were dried down for 1 hour and then resuspended in the same volume of distilled water. An optical density reading was taken and each primer was diluted down to a concentration of 10 pmol. The primers generated and used are as follows:
N-myc Fwd primer: 5’ GACCACAAGGCCCTCAGTAC 3’,
N-myc Rev primer: 5’ GTGGACATACTCAGTGGC 3’,
Id2 Fwd primer: 5’ CGATGAGCCTGCTATACAAC 3’,
Id2 Rev primer: 5’ CCACACAGTGCTTTGCTGTC 3’,
Survivin Fwd primer: 5’ AGGCTGGCTTCATCCACTG 3’, and
Survivin Rev primer: 5’ CTTGGCTCTTTCTCTGTCC 3’. Actin primers were provided by Dr. Rubin’s laboratory. Primers were designed so that they spanned at least one intron as a test of DNA contamination when PCR results were viewed.
Polymerase Chain Reaction
The polymerase chain reaction was completed for the following transcripts: N-myc, Id2, survivin, and actin. PCR reactions were carried out with the following reagents: 1 ul of 1:10 dilution cDNA, 5 uls 10x Reaction Buffer, 1.5 uls of 50mM magnesium chloride, 4 uls of 2.5mM dNTPs, 36.25 uls of distilled water, 1 ul of each set of forward and reverse primers, and 0.25 uls Taq polymerase. Template cDNA was used from each of the six cell lines in conjunction with each of the four sets of primers to make twenty-four reactions. Thermal cycler conditions were as follows: 94°C for 1 minute, then 33 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute. Finally, there was an extension at 72°C for 7 minutes followed by cooling of the samples to 4°C. Another set of PCR reactions were performed at 34 cycles that showed N-myc bands from the SK-N-SH (SH-SY-5Y) and SMS-JMN cell lines (data not shown). Five uls of PCR product from each reaction were run on a 0.8% agarose gel containing ethidium bromide and viewed under UV light. A picture was taken using the Quantity One computer program.
PCR Purification
PCR products were purified using the Life Technologies PCR Purification Kit. A PCR product for each gene was purified by adding 400 uls of Binding Solution (H1) to the amplification reaction, loading this mixture in a cartridge placed in a wash tube, centrifuging at 13,000 rpm for 1 minute, and then discarding the flow-through. The cartridge was washed in the same way with Wash Buffer (H2) and any residual wash buffer removed by centrifuging again for 1 minute at 13,000 rpm. The purified DNA was then eluted with the addition of 30 uls of 70°C distilled water and a final spin in the centrifuge at 13,000 rpm for 2 minutes.
Sequencing
DNA sequencing was performed on the purified PCR products of the four different genes using the Sanger Dideoxy method of sequencing. Fifty fmol of purified PCR product were added to 4 uls of 10x cycling buffer, 0.2 uls of alpha 33P-dATP, 2 uls of a primer, and enough distilled water for a total volume of 30 uls. Then, each tube was further divided into 4 tubes where 6 uls of the previous mixture were then added to 2 uls of the corresponding ddNTP. Finally, a drop of mineral oil was overlaid onto each tube to prevent evaporation, and the tubes were placed in the thermal cycler under the following conditions: 35 cycles of denaturing at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and elongating at 72°C for one minute. The samples were held at 4°C upon completion. Four uls of stop solution were then added to each tube and all tubes were heated at 94°C to denature the sequencing products. Finally, 3 uls of each reaction were run on a sequencing gel for 1.5 hours. The gel was then dried for one hour and exposed overnight to x-ray film. The sequences were read using the MacVector software and compared to the complete gene sequences using Clustal W Alignment.
Densitometric Scanning
PCR bands observed on the gel were subject to densitometric scanning using the Sigma Gel software provided generously by Dr. R. Ross, Fordham University, New York. Density values were represented by the area under the curves plotted for the intensity of each individual band. Each band ‘density’ was compared across all six cell lines with the highest value for each gene corresponding to 100% of the total expression of that gene. The values remaining for the bands of each gene are computed as a percentage of the highest value.
RESULTS
Total RNA was extracted, as described in materials and methods, from the six neuroblastoma cell lines and run on a 0.8% agarose gel (Fig. 1). The 28S and 18S RNA subunits are clearly visible in all cell lines at approximately 1.7kb and 0.85kb, respectively. Genomic DNA is still present (note bands across the top) as this is prior to DNase treatment. The RNA was shown to be intact and suitable for further DNase treatment and first strand synthesis.
PCR of the six neuroblastoma cell lines with primers for N-myc, Id2, survivin, and actin were performed as described in materials and methods (33 cycles)(Fig. 2). PCR product from cell line SK-N-SH (SH-SY-5Y) were loaded in lanes 1-4, SMS-JMN PCR product in lanes 5-8, LA-N-6 in lanes 9-12, LAN-1 (LA1-55n) in lanes 13-16, BE(2)-M17 in lanes 17-20, and KCN-69N in lanes 21-24. N-myc was loaded (at 552 bp) in lanes 1,5,9,13,17 and 21; Id2 (307 bp) in lanes 2,6,10,14,18, and 22; survivin (at 213 bp) in lanes 3,7,11,15,19, and 23; and actin (at about 680 bp) in lanes 4,8,12,16,20 and 24. The non-amplified N-myc cell lines, as expected, showed little (3rd cell line LA-N-6) or hardly any N-myc DNA product (1st and 2nd cell lines, SK-N-SH and SMS-JMN). These two cell lines, SK-N-SH (SH-SY-5Y) and SMS-JMN did show bands for N-myc at a PCR conducted at 34 cycles (data not shown). There is no DNA contamination as evidenced by the fact that only one band is seen per lane. Because the primers spanned at least one intron, if there were DNA contamination, a longer sequence would have been amplified and there would be bands of DNA visible above the bands seen in this picture. Densitometric scanning shows relative numbers of the intensity of each band as a percentage of the highest value for each respective gene's bands (Table 1). The three amplified N-myc cell lines clearly showed more intense bands for N-myc than the non-amplified N-myc cell lines as is shown by the data. There seems to be no significant difference or pattern in survivin expression when comparing the N-myc amplified to the N-myc non-amplified cell lines. In addition, surprisingly, the same was true for Id2. The N-myc amplified cell lines do not all necessarily increase expression of Id2 such that they are greater than the Id2 expression of non-amplified N-myc cells.
Sequencing of four different purified PCR products, i.e., that of N-myc, Id2, survivin, and actin show that the bands observed by PCR amplification are indeed those of the genes targeted by the gene-specific primers, i.e. there is greater than 99% homology (data not shown).
DISCUSSION
Findings have correlated NB development with aberrations of two crucial cellular processes, that is, the cell division cycle and apoptosis. N-myc can both selectively cause sympathetic neurons to reenter the cell cycle and protect them from apoptosis. Id2 was reported to be involved in the N-myc-Id2 pathway, and could consequently hamper pRb antiproliferative activity. In addition, survivin, which is an inhibitor of the apoptotic response, makes NBs more resistant to programmed cell death(1). Thus, it seems that NB cells have acquired the capability to proliferate easily (by reentering the cell cycle) and die difficultly (by inhibiting apoptosis).
It is clearly seen that N-myc is indeed amplified in the N-myc amplified cell lines according to the densitometric scanning results. However, the findings presented also suggest that Id2 is not overexpressed due to N-myc amplification. The values obtained from the densitometric scanning did not show significant differences between the two cell types, that is, N-myc amplified vs. N-myc non-amplified, and, in one case, a non-amplified N-myc cell line has a higher densitometric scanning value for Id2 than an amplified N-myc cell line. The same holds true for survivin in that there is no significant difference between the two cell types in the values obtained from densitometric scanning.
Cell lines #1 (SK-N-SH) and #4(LAN-1) have been reported in previous studies where it was shown that Id2 expression is significantly greater in the N-myc amplified cell line as opposed to the non-amplified cell line. This conclusion was made with 10 different NB cell lines, only two of which I have tested, and in which the statement: ‘N-myc amplification causes Id2 overexpression’ is potentially true. However, there is no known research on the other four cell lines I have tested to support this hypothesis. My findings may suggest that Id2 is overexpressed in only certain N-myc amplified cell lines, or more importantly, that Id2 overexpression is not entirely caused by N-myc amplification. Very recently (April, 2002), however, there has been new research to suggest that there is no correlation with N-myc amplification and Id2 overexpression (personal communication, Barbara Spengler, Fordham University). It would be interesting to know, more precisely, the correlation between N-myc and Id2 and the mechanism by which each functions. Further studies could also be done to study the other Id family of proteins and to determine their relationship, if any, to N-myc.
Survivin did not show a significant difference between the two cell types and therefore it may be concluded that there is no correlation between N-myc amplification and survivin expression. It may have been an auspicious finding if there were a correlation between N-myc and survivin in terms of new therapeutic strategies that could develop in fighting off neuroblastomas.
I would like to thank Dr. R. Ross and Barbara Spengler for providing their time, their valuable advice, and the neuroblastoma cells needed for this project. I would also like to acknowledge Dr. Rubin for providing his lab and resources and for allowing me to gain such valuable skills and techniques. Finally, I would like to thank Sabrina Volpi and Rocco Coli for their patience, tremendous support, and guidance throughout the semester.
REFERENCES
1.Azuhata, T., Scott D., Takamizawa, S., Wen, J., Davidoff, A., Fukuzawa, M., and
Sandler, A. (2001) The inhibitor of apoptosis protein survivin is associated with high
risk behavior of neuroblastoma. Journal of Pediatric Surgery 36(12), 1785-91.
2.Boriello, A., Roberto R., Della Ragione F., and Iolascon A., (2002) Proliferate and
survive: cell division cycle and apoptosis in human neuroblastoma. Haematologica 87,
196-214.
3.Islam, A., Kageyama, H., Takada, N., Kawamoto, T., Takayasu, H., Isogai, E., Ohira,
M., Hashizume, K., Kobayashi, H., Kaneko, Y., and Nakagawara, A. (2000) High
expression of survivin, mapped to 17q25, is significantly associated with poor
prognostic factors and promotes cell survival in human neuroblastoma. Oncogene
19(5), 617-23
4.Islam, A., Hajime, K., Kohei, H., Yasuhiko, K., and Nakagawara, A. (2000) Role of
survivin, whose gene is mapped to 17q25, in human neuroblastoma and identification
of a novel dominant-negative isoform, survivin-b/2B. Medical and Pediatric Oncology
35, 550-553.
5.Lasorella, A., Boldrini, R., Dominici, C., Donfrancesco, A., Yokota, Y., Inserra, A.,
and Iavarone, A. (2002) Id2 is critical for cellular proliferation and is the oncogenic
effector of N-myc in human neuroblastoma. Cancer Research 62(1), 301-6.
6.Lasorella, A., Noseda, M., Beyna, M., and Iavarone, A. (2000) Id2 is a retinoblastoma
protein target and mediates signaling by Myc oncoproteins. Nature 407, 592-98
7.Shankar, S.L., Mani, S.,O’Guin, K.N., Kandimalla, E.R., Agrawal, S., and Zagardo,
B.S. (2001) Survivin inhibition induces human neural tumor cell death through
caspase-independent and –dependant pathways. Journal of Neurochemistry 79, 426-
436.
8.Toma, J.G., El-Bizri, H., Barnabe-Heider, F., Aloyz, R., and Miller, F.D. (2000)
Evidence that helix-loop-helix proteins collaborate with retinoblastoma tumor
suppressor protein to regulate cortical neurogenesis. Journal of Neuroscience 20, 7648-
56.
9.Wartiovaara K., Barnabe-Heider, F., Miller, F.D., and Kaplan, D.R. (2002) N-myc
promotes survivial and induces S-phase entry of postmitotic sympathetic neurons.
Journal of Neuroscience 22(3), 815-824.
10.Weinberg, R.A.(1995) The retinoblastoma protein and cell cycle control. Cell 81,
323-330
| This document was last modified 01/31/2006. This site is powered by the versatile Zope platform. | This is a project of the Biology Department of Fordham University |