Comparative study of expression of Caveolin-1 in normal and tumor breast cell lines




Meeta Thakrar

Introduction

Abstract


Caveolin, a 21-24 kDa integral membrane protein is a principal structural component of caveolae membranes in vivo. Caveolae are small, stationary depressions (rafts) on the plasma membrane consisting of cholesterol and proteins of which caveolin is the important one. They aid the vesicular transport and have also been found to play a role in signal transduction. Caveolin is also associated with certain cancers such as breast, prostate, ovarian and renal. In the present work, I studied the expression of the caveolin-1 mRNA in three breast cell lines; Hs 578Bst, Hs 578T and MDA-MB-231 using RT-PCR and sequence analysis. Caveolin has been thought to be a candidate tumor suppressor gene as it has been mapped to a tumor suppressor region on chromosome 7. However, the present study refutes the role of caveolin-1 as a tumor suppressor as its expression is increased in the tumor cell lines as compared to the normal breast cell line.


Introduction


Caveolae are small, concave, omega-shaped indentations of the plasma membrane that have been implicated in vesicular transport processes and more recently, in signal transduction (Lisanti et al, 1994, Couet et al, 1997). Caveolae are found in most cell types but are extremely abundant in terminally differentiated cell types such as adipocytes (Scherer et al, 1994), simple squamous epithelia (Simionescu and Simionescu, 1983) smooth muscle cells (Forbes et al, 1979) and fibroblasts (Bretscher and Whytock, 1977). Caveolin, a 21-24 kDa integral membrane protein, is a principal structural component of caveolae membranes in vivo (Glenney, 1989, Rothberg et al, 1992 and Kurzchalia et al, 1992). Caveolin is a protein of interest due to these reasons.

Recent studies have shown that caveolin is only the first member of a growing gene family of caveolin proteins; caveolin has been re-termed as caveolin-1. Three different caveolin genes; Cav-1, Cav-2 and Cav-3 encoding four different subtypes of caveolin have been described (Couet et al, 1997). There are two different subtypes of caveolin-1 that differ in their respective translation initiation sites (Scherer et al, 1995). Caveolin-1 has been mapped to the tumor suppressor region of chromosome 7q31.1 wherein, more tumor suppressor genes are suspected to reside. The D7S522 marker is located ~67kb upstream from Cav-2 and Cav-2 is located ~19kb upstream from Cav-1. Hence, caveolin-1 is believed to be a candidate tumor suppressor. In vitro studies by Lee et al, 1998 also support the role of caveolin-1 as a tumor suppressor. However, studies by Hurlstone et al, 1999 refute the role of caveolin-1 as a breast tumor suppressor gene in vivo. The objective of the present study was to study the expression of caveolin-1 mRNA in various breast cell lines.

One normal breast cell line, Hs 578Bst and two breast carcinoma cell lines; Hs 578T from the same patient as Hs 578Bst and an unrelated breast carcinoma cell line MDA-MB-231 were studied for the expression of mRNA for caveolin-1 using the specific primers and molecular techniques such as RT-PCR and DNA Sequence Analysis. The two cell lines from the same patient were derived from epithelial cells while MDA-MB-231 was derived from a pleural effusion of an unrelated patient.
Figures


Figure 1-
Total RNA samples from the three cell lines. Lane 1contains total RNA from Hs 578Bst, lane 2 (Hs 578T) and lane 3 (MDA-MB-231). The two rRNA subunits, 28S and 18S can be seen clearly.


Figure 2-
RT-PCR analysis: Hs578BsT (lanes 1 & 4), Hs578T (lanes 2 & 5), MDA-MB-231 (lanes 3 & 6), actin (lanes 1-3) and caveolin-1 (lanes 4-6). RT-PCR was performed as described in Materials and Methods and 10 mL of the products were run on a 0.8% agarose gel stained with ethidium bromide. Actin primers generated an expected ~700 bp (lanes 1-3) product while caveolin-1 primers generated an expected ~400 bp product (lanes 4-6).


Figure 3-
Arrows indicate the position of the forward and reverse primers used in this experiment. The two primers span the intron between exon 1 and exon 2.


Figure 4-
DNA sequence analysis of the RT-PCR products using Caveolin-1 specific primers shown in Materials and Method. The sequence read from the RT-PCR products (experimental) showed 100% homology to the published Caveolin-1 sequence (GenBank:NM_001753).


Materials and Methods


Cell lines :


Three cell lines designated Hs 578Bst, Hs 578T and MDA-MB-231 were purchased from American Type Culture Collection (ATCC) and were propagated as per the protocol recommended by ATCC.


Harvesting cells :


Cells were harvested using a lysis-buffer containing EDTA-PBS and recovered in 15 ml Falcon tubes in EDTA-PBS. The cell suspension was then pelleted by centrifugation at 5000 rpm for 3 min.


Total RNA Extraction :


The pellets were resuspended in 12 volumes (300 µL) of lysis/binding solution and mixed thoroughly by pipetting. Total RNA was then extracted using RNA AqueousTM (Ambion, Austin, TX) kit and protocol with one variation. In the final step, instead of using warm TBE for the elution of total RNA, warm, deionized water at 65-70°C was used. Using a 1:50 dilution in deionized water and reading the absorbance in a spectrophotometer at 260nm for RNA and at 280nm for any protein contamination determined the concentration of the extracted total RNA. Qualitative assessment of extracted total RNA was done by loading 5-7µL of each sample on a 0.8% agarose gel stained with ethidium bromide and subjecting them to electrophoresis at 100 Amps for 30 minutes and finally visualizing under UV light.


DNase Treatment :


The extracted total RNA from the cells was subjected to DNase treatment using the DNA-freeTM (Ambion, Austin, TX) as per the manufacturer’s specifications to remove any contaminating DNA from the samples. Briefly, 2 µg of total RNA was treated with 0.1 volume of 10X buffer and 1µL of DNase I. The samples were then incubated at 37°C for 20 minutes. To inactivate DNase I, 0.1 volume of inactivating solution (slurry) was added to the samples and incubated at room temperature for 2 minutes. The DNase I and inactivating solution were then pelleted by centrifugation at 12,000X g for 1 minute.


Primers :


Caveolin-1 primers were synthesized in oligonucleotide synthesizer in our lab. Caveolin-1 forward primer is 5’ AACGTTCTCACTCGCTCTCTGCTCGCTGCG 3’ and the reverse primer is 5’ GTACACTTGCTTCTCGCTCAGCAC 3’. These primers were designed such that they spanned the intron between the first and the second exon to ensure that there is no DNA contamination in the PCR product. This set of primers, without any DNA contamination, would generate a 407 bp cDNA piece. With the intron, these primers would generate approximately 1.8kb long piece. Forward and reverse primers for ß-actin (referred to as actin) were supplied in order to serve as a positive control and to verify that there was no PCR inhibition in the reaction mixture or the protocol followed.


RT-PCR :


A two-step RT-PCR technique was employed here - first strand (cDNA) synthesis was followed by PCR. 1µg out of 2µg of DNase-treated RNA was brought upto to a total volume of 9.4µL with dH2O. It was heated at 70°C for 10 minutes, cooled on ice and the contents were spun down. A master mix containing 4µL of 5x 1st strand buffer, 4µL of 2.5mM dNTP’s (deoxyribose nucleotide triphosphates), 0.6µL of Qt primer (primer that consists of 17 nucleotides of oligo (dT) and 2µL of 0.1mM DTT (Dithiothreitol) was prepared. 1µg of DNase-treated RNA was added to the master mix, followed by 1µL (200 U) of Superscript II RT (reverse transcriptase) and the contents were mixed thoroughly. After incubating for 5 minutes at room temperature, cDNA synthesis was performed in a Perkin Elmer 2400 thermocycler at 42°C for 1 hour, followed by 50°C for 10 minutes and then 70°C for 15 minutes to inactivate the reverse transcriptase enzyme. 1.5 Units of RNaseH were subsequently added and the whole mixture was incubated at 37°C for 15 minutes to degrade all the ssRNA and RNA-cDNA.

These first strand synthesis products (cDNA) were then used as templates for the subsequent PCR amplification. After optimization, a 1:100 stock of cDNA from all three cell-lines was prepared for the amplification of actin and a direct cDNA (1:1) was used for the amplification of caveolin-1 as it produced a very weak signal at 1:100 or 1:10 dilution. A 7X master-mix containing 35µL of 10X PCR buffer, 28µL of 2.5mM dNTPs, 10.5µL of 50mM MgCl2 , 1.75µL of Taq DNA polymerase and 254µL of dH2O was prepared in a 1.5 ml tube for a total of six reactions. 1µL each of the respective cDNA template for the three cell lines and the respective forward and reverse primers were then added to each individual PCR tubes to make a total volume of 50µL in each tube. PCR amplification was carried out in a Perkin Elmer thermocycler by carrying out the initial denaturation of the dsDNA at 94°C for 5 minutes, then cycled for 30 times for actin and for 45 cycles for caveolin-1 to prevent saturation of actin, The PCR reaction was carried out at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute. A final extension was carried out at 72°C for 7 minutes. Detection of the PCR product was done by running 10µL of the product on a 0.8% agarose gel stained with ethidium bromide and visualizing under UV light.


PCR Purification :


The PCR products were purified by CONCERTTM Rapid PCR Purification system (Life Technologies) with just one modification. The purified DNA was eluted in 25µL of dH2O preheated to 70°C, was then incubated at room temperature for 30 seconds, 70°C for 30 seconds and again at room temperature for 30 seconds before centrifugation at ≥ 12,000 X g for 2 minutes.


DNA Sequence Analysis :


DNA sequencing was performed using a modified version of the Sanger Dideoxy Sequencing method using AmpliCycle Sequencing Kit (Perkin Elmer, Norwalk, CT). 50 fmoles of purified PCR products were mixed with 4µL of 10X cycling buffer, 0.2µL of α33P-dATP and dH2O to a total volume of 30µL. 6µL of this master mix was then added to four tubes, each containing 2µL of either ddGTP, ddATP, ddTTP, or ddCTP to make a total volume of 8µL. Next, a drop of mineral oil was added to each tube in order to prevent evaporation during the subsequent sequencing reaction. The sequencing reactions were conducted in a thermocycler for 35 cycles by denaturing at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and elongating at 72°C for 1 minute. Following the sequencing reactions, 4µL of stop solution was added to each tube and they were then heated to 94°C for 3 minutes to denature the products before running them on a sequencing gel.


Densitometric Scanning :


Quantitative analysis of the obtained PCR results was done by performing densitometric scanning using Sigma-Gel software. The bands obtained on the agaorse gel were scanned and quantified using Sigma Gel by integrating the area covered by the peaks.



Results


Total RNA was extracted from all three breast cell lines as described in Materials and Methods (Refer "Full Paper") and was then electrophoresed on 0.8% agarose gel. All three cell-lines showed sharp, intense bands corresponding to 28S and 18S ribosomal subunits (Fig.1). Thus, the RNA extracted was confirmed to be not degraded. The bands seen in each lane at the top, near the wells represent the genomic DNA as the total RNA was run on the gel before DNase treatment.

RT-PCR was performed as described in materials and methods and the products obtained with specific primers for caveolin-1 and actin cDNA were run on 0.8% agarose gel. Figure 2 shows that all three cell lines display actin pulled out with β-Actin specific primers, which serves as a positive control at an expected size of 700 bp. Lane 1, 2 and 3 represent actin from Hs578Bst, Hs578T and MDA-MB-231 cell lines respectively. This showed that the samples had amplifiable DNA and lacked PCR inhibitors. The segment of caveolin-1 amplified with its specific primers is expected to be 407 bp long. All three cell lines show clean bands of varying intensities at approximately 400 bp of the 100 bp ladder which indicates for the expected caveolin-1 cDNA segment (Fig.2, lanes 4-6). Hs578Bst, a normal breast cell line, shows a slightly faint band of caveolin-1 (Fig. 2, lane 4), Hs578T, a breast carcinoma cell line from the same patient from which Hs578Bst was also derived, shows a brighter band (Fig.2, lane 5) while MDA-MB-231, an unrelated breast carcinoma cell line shows the band with highest intensity.

Further, densitometric scanning of the RT-PCR results provided a way to quantitatively analyse the results obtained above. Although actin shows some decrease from normal to the tumor cell lines (Table 1), caveolin-1 shows an abrupt, nearly two-fold increase from Hs 578Bst (normal) to Hs 578T and a three-fold increase in MDA-MB-231 compared to the normal cell line(Table 1).


 Hs 578Bst Hs 578T MDA-MB-231
Actin 100% 93% 78%
Caveolin-1 100% 215% (~2 fold) 302% (~3 fold)

Table 1: Densitometric scanning of RT-PCR results using Sigma Gel.



Figure 3 shows the positions of introns and exons of Cav-1 gene. The forward primer for caveolin-1 falls in exon-1 and the reverse primer, in exon-2. The primers used in this experiment, shown by arrows, generated a 407 bp piece without the intron while ~1.8 kb piece along with the intron. Since the PCR product formed a band at ~400 bp on the agarose gel, it confirms that there was no DNA contamination in the PCR product after the DNase treatment and that the PCR product was formed the cDNA and not the genomic DNA.

Sequence analysis of the cDNAs obtained corresponding to caveolin-1 show that the forward readable sequence of 111 bp and the reverse readable sequence of 147 bp shows 100% homology to the caveolin-1 sequence published by Gen Bank, accession # NM_001753 (Figure 4).



Discussion


Caveolin-1 gene has been mapped to a tumor suppressor region of human chromosome 7q31.1 containing the marker D7S522. Although no genes have been localized to the D7S522 locus, it is found to be located ~67 kb upstream of the caveolin-2 gene and caveolin-2 gene is located ~19 kb upstream of the caveolin-1 gene and some tumor suppressor genes have been suspected to be located in this region. Caveolin-1, therefore, is a candidate tumor-suppressor [Engleman et al, 1998]. Studies by Lee et al, 1998 also support the role of caveolin-1 as a tumor growth suppressor in vitro based on mRNA expression. Hurlstone et al, 1999 deny the role of caveolin-1 as a tumor suppressor in vivo. Here, I studied the mRNA expression of caveolin-1 in three breast cell lines and am trying to find evidence for one of these contrasting theories.

My data from RT-PCR show that there is an increased production of caveolin-1 in the affected, carcinoma breast cell lines as compared to the normal breast cell lines. The band intensity at 400 bp on the agarose gel, corresponding to the 407 bp piece of caveolin-1 identified by the primers specified in Materials and Methods, is increasing from normal Hs578Bst cell line (Fig.2, lane 4) to carcinoma cell line Hs578T (Fig.2, lane 5) from the same patient to that from MDA-MB-231, an unrelated breast carcinoma cell line (Fig.2, lane 6). Thus, expression of caveolin-1 is increased in the breast carcinoma cell lines as compared to a normal breast cell line. Lee et al, 1998 support the role of caveolin-1 as a tumor based on their in vitro studies involving re-expression of caveolin-1. However, this reexpression was accomplished by transfection of the cDNA into breast tumor cells in which no basal levels of caveolin-1 were detected. This could lead to some complications resulting from overexpression which might be further reflected in the data. In addition, the in vitro conditions employed in their study do not imitate the normal conditions for the cells and may cause the transformed cells to behave differently. On the other hand, Hurlstone et al, 1999 detected a very high expression of caveolin-1 in breast tumor cells lines in vivo while it was nearly undetectable in the normal breast cell line. The data obtained here agree with Hurlstone et al, 1999 except in that some level of caveolin-1 was also detectable in the normal breast cell line, although at a high PCR cycle number of 45.


Conclusion


In all, the data presented here appear to refute the possibility of caveolin-1 being a tumor suppressor, based on its expression at transcriptional level as also concluded by Hurlstone et al, 1999. Whether the difference in the expression in normal cell lines is due to in vitro cell culture conditions or otherwise remains to be studied.

Full Paper

Acknowledgments

Sincere thanks to Sabrina Volpi and Rocco Coli for their standing help and guidance throughout this project. Thanks to Dr. Berish Rubin for giving me this opportunity to undertake this independent piece of work and for ordering the cell lines and other material for the same. I am very grateful to Dr. Raj Kandpal and Nagrajan Ganachari for helping me grow the cell lines studied here and for maintaining them throughout this project. I’m also thankful to Dr. Michael Risley for useful discussion and Dr. Robert Ross, Sharon Thomas and Brooke Barton for help with Sigma Gel. Thanks to Manish Pandya for help with the computer. At last, thanks to my colleagues Milu Ahmed and Kerem Pilavci for useful discussions during the course of the work.




References


1.Lisanti M.P,Scherer P,Tang Z.-L, Sargiacomo M. (1994) Trends Cell Biol. 4: 231-235
2.Couet J, Li S, Okamoto T, Scherer P.S, Lisanti M.P. (1997) Trends Cardiovas. Med. 7:103-110
3.Scherer P.E, Lisanti M.P, Bldini G, Sargiacomo M, Corley-Mastick C, Lodish H.F. (1994) J. Cell Biol. 127:1233-1243
4.Scherer P.E, Okamoto T, Chun M, Nishimoto I, Lodish H.F, Lisanti M.P. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:131-135
5.Simionescu N. and Simionescu M. (1983) in Histology : Cell and Tissue Biology (Weiss L.,ed),Fifth Ed. Pp. 371-433, Elsevier Biomedical, New York
6.Forbes M.S, Rennels M, NelsonE.(1979) J. Ultrastruc.Res. 67 :325-339
7.Bretscher M. and Whytock S.(1997) J. Ultrastruc.Res. 61:215-217
8.Glenney J.R. Jr. (1989) J. Biol. Chem.264:20163-20166
9.Rothberg K.G, Heuser J.E, Donzell W.C, Ying Y, Glenney J. R, Anderson R. G. W.(1992) Cell 68:673-682
10.Kurzchalia T, Dupree P, Paraton R.G, Kellner R, Virta H,Lehnert M,simons K. (1992) J. Cell Biol. 118:1003-1014
11.Engelman J. A, Xiao L. Z, Lisanti M. P. (1999) FEBS Letters 448:221-230
12.Lee S. W, Corinne R. L, Oh P, Campbell D. B, Schnitzer J. E. (1998) Oncogene 16:1391-1397
13.Hurlstone A.F.L, Reid G, Reeves J.R, Fraser J, Strathdee G, Rahilly M, Parkinson K.E, Black D.M. (1999) Oncogene 18:1881-1890


This document was last modified 01/31/2006.
This site is powered by the versatile Zope platform.
This is a project of the Biology Department of Fordham University
Biotechniques.org Home