Introduction
Nitrification rates are higher in urban oak forests in the New York City area than in similar rural forests in Connecticut. It is possible autotrophic nitrifying bacteria are stimulated by the activities of exotic earthworms in the urban forests, resulting in increased NO3- levels. Inorganic medium was used to isolate N02- -oxidizing bacteria from rural (Macedonia Park, Connecticut) and urban (Van Cortlandt Park) soils, and molecular methods were used to identify the isolates. DNA was extracted from contaminated N02- -oxidizing cultures with the Chelex® 100 method. A 397 bp portion of the Nitrobacter 16S rRNA gene was amplified by PCR using the Nitrobacter sp.-specific primer 5’ TTTTTTGAGATTTGCTAG 3’ and the nonspecific primer 5’ CTAAAACTCAAAGGAATTGA 3’. PCR products were purified with the QIAquick PCR Purification kit. The Sanger method, using 33P-dATP as the radioactive label, was used to sequence the PCR products, and the GenBank database was used for identification. A 400 bp band was detected for the Macedonia Park isolate but not for the Van Cortlandt Park isolate. 275 bp were homologous to Nitrobacter spp. The Macedonia Park culture also had motile rods and oxidized N02- to N03-. These characteristics suggest the isolate from Macedonia Park was Nitrobacter sp. |
Figure 1-Amplification product for Macedonia Park nitrie-oxidizing isolate. Two primers from the 16S rRNA gene generated a 397 bp segment of DNA for Nitrobacter species. The position of the amplification signal is close to the expected size of 397 bp when compared to a 100 bp ladder marker.
Figure 2-A 275 bp segment of the 16S rRNA gene from Macedonia Park nitrite-oxidizing bacteria compared to the entire 16S rRNA sequence for Nitrobacter winogradskyi (L11661, N. sp. (L11662), N. hamburgensis (L1166l). All four segments are highly homologous.
Results
DNA from the isolates of rural soil but not from urban soil was extracted with the Chelex® 100 extraction method, resulting in a PCR product of approximately 400 bp (Fig. 1). The two primers used were known to target a 397 bp section of the 16S rRNA specific for Nitrobacter spp. but not for the related genera Rhodopseudomonas palustris, Bradyrhizobium japonicum, Photorhizobium thompsonianum, and Agrobacterium tumefaciens. The primers used were Nitrobacter spp.-specific primer (5’ TTTTTTGAGATTTGCTAG 3’ [FGPS1269’] and the nonspecific primer (5’ CTAAAACTCAAAGGAATTGA 3’ [FGPS872]. The the Sanger method was used to sequence the rural isolate PCR product. 275 bp of the approximately 400 bp sequenced were entered into the MacVector program (Apple computer program) and compared to known Nitrobacter spp, 16S rRNA sequences. The 275 bp were highly homologous to Nitrobacter winogradskyi, N. hamburgensis, N. agilis, and N. genomic species 2 at the 896 to 1171 positions on the 16S rRNA gene (Fig. 2).
Discussion
Molecular techniques offer alternative or additional means of identifying autotrophic nitrifying bacteria. These bacteria are slow to grow and can take weeks or months to obtain a population large enough to detect by the appearance or disappearance of nitrite. Molecular techniques offer a means of identifying these organisms, even when the cultures are contaminated. Because bacterial biomass is often small, obtaining enough DNA can be a problem. The Chelex® 100 extraction method allows crude extract to be used for PCR rather than pure DNA. About 100 ul of medium was left with the cell pellet of the urban isolate, so the crude lysate was probably diluted, possibly explaining why no DNA was obtained. Nitrobacter may not have been present also. Typically, more than one characteristic is used to classify bacteria to the genus and species level. The rural isolate is most likely a Nitrobacter because morphological, metabolic, and genetic characteristics were consistent with this genus. Dark phase microscopy showed many motile rods, nitrite was oxidized to nitrate, and a portion of its 16S rRNA was homologous to other Nitrobacter spp. To conclusively identify this organism as a Nitrobacter and to determine the species, further molecular studies need to be done. This could include both the analysis of the entire 16S rRNA sequence or the use of DNA-DNA reassociation experiments.
I gratefully thank Dr. Berish Rubin for allowing me to learn and explore a topic that interested me. I could not have learned as much as I did and realized how much I still need to learn if it hadn't been for the patience and guidance of my instructors, Rocco Coli and Sabrina Volpi. Thank you all.
| This document was last modified 01/31/2006. This site is powered by the versatile Zope platform. | This is a project of the Biology Department of Fordham University |